How was sequencing done before PCR was invented?

Posted by Jack on December 14, 2022
Table of Contents

    Introduction

    The polymerase chain reaction (PCR) is a process that allows scientists to amplify small amounts of DNA. This technique has revolutionized genetics and biotechnology, but it's not the only way researchers have been able to sequence strands of DNA. Let's take a look at how scientists used to sequence DNA before PCR was invented.

    The first step in sequencing DNA is to make lots of copies.

    The first step in sequencing DNA is to make lots of copies. Once you have your sample, you have to replicate it many times so that each copy can be sequenced. To do this, we use polymerase chain reaction (PCR). PCR uses a special enzyme called Taq polymerase and two primers: one primer attached to the template strand and another primer attached to the non-template strand. The enzyme binds to each primer and creates new DNA strands that are complementary copies of the original template strand. Each newly created strand has one of two sequences: either one end will match its respective primer sequence or both ends will match both primer sequences at once. The latter scenario leads us back up our previous learning path as it means we've got an exact copy of our template sequence!

    Before PCR, scientists used alternative methods to replicate DNA.

    DNA sequencing was not always done with PCR. Before this breakthrough, there were two primary methods of DNA sequencing: Sanger's method and Maxam-Gilbert sequencing. The Sanger method was easier to use and more popular among scientists, but the Maxam-Gilbert method was more precise and could be used on shorter fragments of DNA.

    The Sanger method works by breaking up a piece of DNA into smaller strands using heat or enzymes that degrade bonds between bases in the double helix strand. It then adds primers (short sequences of DNA) to specific sections of those fragments—one primer at each end—and subjects them to polymerase chain reaction (PCR). After this process is complete, an enzyme called Taq polymerase can attach nucleotides onto these areas where primers were added earlier on in the process. When all four base types have been added, you've got yourself a full strand! This technique works well for short nucleic acids because it doesn't require much starting material; however, it does not work so well when you need longer pieces because each round of replication will result in only one new piece instead of multiple versions which means your chances for getting successful results drops significantly over time as length increases exponentially beyond 5kb sequences."

    The Sanger method was more popular and simpler than Maxam-Gilbert sequencing.

    The Sanger method is a simpler process than Maxam-Gilbert sequencing, which is why it was more popular. The Maxam-Gilbert method requires 300 steps, while the Sanger method requires only four.

    Sequencing DNA before PCR was invented required either the Sanger method or the Maxam-Gilbert method. The first human genome was sequenced using the Maxam-Gilbert method by Fredrick Sanger and colleagues in 1984 (2).

    The Sanger method fragmented DNA and used specific primers and enzymes to add bases to the fragments.

    The Sanger method involves the following steps:

    • Fragmentation of DNA. The DNA is broken into smaller pieces using a chemical called restriction endonuclease, or restriction enzyme. This enzyme cuts DNA at specific sites (the recognition sequence).
    • Synthesis of new bases. Once the fragments are fragmented, they are attached to primers—short sequences of nucleotides that bind to either end of a single strand of DNA—and then made ready to be sequenced by a process called primer extension. This process occurs in two phases: (1) polymerase chain reaction (PCR), where nucleotides are added one by one; and (2) gel electrophoresis, where the bands corresponding to each base pair within an individual fragment move in relation to their size as they're separated by an electric field over time so that you can read what base pairs appear when compared with known standards like blue dye for A/T or black dye for G/C pairs

    The Maxam-Gilbert method used chemical reactions to add individual bases to a DNA strand.

    The Maxam-Gilbert method used chemical reactions to add individual bases to a DNA strand. The enzyme DNA polymerase is used to make many copies of the target sequence, but in order for this reaction to occur, each new copy must be complementary—it must match the template strand at that position. This means that you need some way of getting rid of all but one base in your sample before you get started.

    For example, if I want to amplify a piece of DNA containing Adenine (A), Thymine (T), Guanine (G) and Cytosine (C), my target sequence would be something like AATCGCCCTTTGTCACAGCATGCGTAAGGAAAACTGCAACGGACAGTGCTCTAGACCAAGTGCAAACCCTTTCAATCTTGTAACAACTAATAACCATTGTCATGAACCCAAAGTGAAAATTATAACACCACTGTCCCGGTGGAAACAATGTTAATAATTGGTAAAAAATGCAAAAGGGGCAAAAGTCAACCTTTTTCCCGTTTTTTAAA

    PCR took the Sanger method and automated it so that massive amounts of DNA could be replicated rapidly and cheaply.

    PCR is a more efficient way to replicate DNA. It uses heat, enzymes and nucleotides to replicate DNA in a small tube.

    The process was invented by Kary Mullis in 1983. It has become the gold standard for sequencing because it can be done in a laboratory, but is also used in the field to help diagnose diseases like malaria and AIDS where there is no electricity or running water.

    PCR is more accurate than other methods because you are only amplifying one strand of your sample at a time so that you don't get any errors from contamination or overlapping samples (this doesn't happen with Sanger sequencing). This means that you have an exact copy of your original sample instead of just parts of it! PCR also takes less time than other methods because each step can be done quickly while heating up strands being copied until they reach their melting point - this means all your bases are aligned at once when they're ready to be copied!

    Sequencing DNA was a time-consuming process before PCR was invented.

    Sequencing DNA is a time-consuming and expensive process; the method used before PCR was invented was labor-intensive. To sequence a single piece of DNA, you would have to spend hours using gel electrophoresis (an experimental technique that separates molecules based on size) to identify which base at each position in your strand matched up with its complementary base. This could take days or even weeks! And if you wanted to sequence multiple pieces of DNA? You'd be in for some serious work: each piece would need to be separated out by size and then sequenced individually—and this process would still require many days or weeks for each one.

    Then came PCR: by using more modern equipment like thermal cyclers, scientists were able to speed up their sequencing efforts immensely by making hundreds of thousands—even millions—of copies of their strands at once, cutting down on expensive time investments while simultaneously producing more accurate results than they had before.

    Conclusion

    PCR is a powerful tool for sequencing DNA and has revolutionized the way we do this. It’s relatively simple, inexpensive and quick compared with older methods. If you want to learn more about PCR and how it works, check out our other blog posts on this topic!

    avonbiehl
    Copyright 2021 - 2023 by Avonbiehl.com
    Privacy Policy
    We use cookies in order to give you the best possible experience on our website. By continuing to use this site, you agree to our use of cookies.
    Accept